If one strand (side) of DNA has the order of nucleotides: TACCGCTGTTGTCAAGGAACTCCATAG, then what is the complimentary order of nucleotides in the other strand of DNA.
Related Questions
- If one strand (side) of DNA has the order of nucleotides: TACCGCTGTTGTCAAGGAACTCCATAG, then what is the complimentary order of nucleotides in the other strand of DNA.
- If one strand (side) of DNA has the order of nucleotides: TACCGCTGTTGTCAAGGAACTCCATAG, then what is the complimentary order of nucleotides in the other strand of DNA.
- Why does a mutation that deletes one or two DNA nucleotides changes gene function more drastically than a substitution of one nucleotide for another type?