Important Notice: Our web hosting provider recently started charging us for additional visits, which was unexpected. In response, we're seeking donations. Depending on the situation, we may explore different monetization options for our Community and Expert Contributors. It's crucial to provide more returns for their expertise and offer more Expert Validated Answers or AI Validated Answers. Learn more about our hosting issue here.

If one strand (side) of DNA has the order of nucleotides: TACCGCTGTTGTCAAGGAACTCCATAG, then what is the complimentary order of nucleotides in the other strand of DNA.

0
ac23 ac23 Posted

If one strand (side) of DNA has the order of nucleotides: TACCGCTGTTGTCAAGGAACTCCATAG, then what is the complimentary order of nucleotides in the other strand of DNA.

Related Questions

What is your question?

*Sadly, we had to bring back ads too. Hopefully more targeted.